Archives

  • 2026-06
  • 2026-05
  • 2026-04
  • 2026-03
  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10
  • 2025-09
  • 2025-08
  • 2025-07
  • 2025-06
  • FLAG tag Peptide (DYKDDDDK): Atomic Benchmarks for Recomb...

    2025-12-04

    FLAG tag Peptide (DYKDDDDK): Atomic Benchmarks for Recombinant Protein Purification

    Executive Summary: The FLAG tag Peptide (DYKDDDDK) is an 8-amino acid sequence used as an epitope tag for recombinant protein purification and detection (APExBIO). It enables gentle elution from anti-FLAG M1 and M2 affinity resins due to its enterokinase-cleavage site. The peptide exhibits high aqueous solubility (>210.6 mg/mL in water) and is supplied at >96.9% purity as confirmed by HPLC and mass spectrometry. Routine working concentrations center at 100 μg/mL. The peptide is not suitable for elution of 3X FLAG fusion proteins, which require a 3X FLAG peptide instead (Sawyer et al., 2024).

    Biological Rationale

    The FLAG tag Peptide (sequence: DYKDDDDK) is extensively used as an epitope tag for recombinant protein purification and detection (APExBIO). Epitope tags enable rapid isolation and characterization of recombinant proteins by providing a defined antibody recognition site (see structural insights). The FLAG tag is recognized specifically by anti-FLAG M1 and M2 monoclonal antibodies. Its 8-amino acid sequence is minimally immunogenic and rarely interferes with protein folding or function. The tag is frequently incorporated at the N- or C-terminus of recombinant proteins via standard molecular cloning techniques. It enables detection via Western blot, immunoprecipitation, and immunofluorescence. The enterokinase-cleavage site (DDDK) embedded within the tag allows for sequence-specific removal after purification, minimizing residual amino acid sequence.

    Mechanism of Action of FLAG tag Peptide (DYKDDDDK)

    The FLAG tag Peptide (DYKDDDDK) functions as a high-affinity ligand for anti-FLAG M1 and M2 antibodies. When fused to a target protein, it enables specific binding to antibody-coupled affinity resin. Elution is performed by competitive displacement using exogenous FLAG tag peptide or enzymatic cleavage at the enterokinase site. The DYKDDDDK sequence includes a cluster of aspartic acid residues, conferring strong negative charge and enhancing solubility. The peptide's design allows for efficient, gentle elution at physiological pH, preserving protein integrity. The enterokinase-cleavage site within the tag enables post-purification removal, yielding native-like recombinant proteins (Sawyer et al., 2024).

    Evidence & Benchmarks

    • High purity: The APExBIO FLAG tag Peptide (A6002) is supplied at >96.9% purity, as confirmed by HPLC and mass spectrometry analyses (APExBIO).
    • Solubility: The peptide is highly soluble, with reported solubility values of 210.6 mg/mL in water, 50.65 mg/mL in DMSO, and 34.03 mg/mL in ethanol at room temperature (product specification sheet, APExBIO).
    • Elution specificity: The DYKDDDDK peptide efficiently elutes standard FLAG fusion proteins from anti-FLAG M1 and M2 resins, but does not elute 3X FLAG fusion constructs; for these, a 3X FLAG peptide is required (Sawyer et al., 2024).
    • Working concentration: The recommended working concentration for competitive elution is 100 μg/mL, optimizing recovery without non-specific protein elution (see precision epitope tag guide).
    • Storage stability: The solid peptide is stable when stored desiccated at -20°C. Peptide solutions are not recommended for long-term storage and must be used promptly (APExBIO).
    • Experimental benchmarks: Enterokinase cleavage enables removal of the tag without altering downstream protein structure or function, as validated in structural biology workflows (Sawyer et al., 2024).

    Applications, Limits & Misconceptions

    The FLAG tag Peptide is a cornerstone reagent in protein purification, detection, and functional assays. It is compatible with Western blot, ELISA, immunoprecipitation, affinity chromatography, and structural studies. Its minimal sequence reduces immunogenicity and steric hindrance, supporting use in diverse expression systems, including bacteria, yeast, insect, and mammalian cells. The peptide's high solubility facilitates rapid dissolution and efficient elution protocols, reducing aggregation risk (advanced protocols). However, its use is constrained by tag accessibility, potential proteolytic cleavage in some host systems, and incompatibility with multi-tag (e.g., 3X FLAG) constructs.

    Common Pitfalls or Misconceptions

    • The standard FLAG tag Peptide (DYKDDDDK) will not elute 3X FLAG fusion proteins from affinity resin; a 3X FLAG peptide is required for such applications (Sawyer et al., 2024).
    • Long-term storage of FLAG tag peptide solutions leads to degradation; only solid form is recommended for storage at -20°C (APExBIO).
    • Tag accessibility may be hindered if the recombinant protein folds in a way that buries the epitope, reducing binding efficiency.
    • Proteolytic cleavage can occur in some expression hosts, removing the tag and preventing detection or purification.
    • High concentrations of peptide (>1 mg/mL) may result in non-specific elution or resin saturation, compromising purity.

    This article extends prior coverage (e.g., structural insights & innovation) by providing updated quantitative solubility and storage parameters sourced directly from APExBIO's A6002 kit, and clarifies practical limits in standard workflows.

    Workflow Integration & Parameters

    The FLAG tag Peptide (DYKDDDDK) is integrated during recombinant protein design by encoding its DNA sequence (GACTACAAGGACGACGATGACAAG) at the N- or C-terminus of the target gene. Expression is performed in suitable host systems. After cell lysis, the tagged protein is captured on anti-FLAG M1 or M2 resin. Elution is achieved by adding 100 μg/mL FLAG tag peptide or via enterokinase cleavage at the DDDK site. The peptide dissolves rapidly in water, DMSO, or ethanol. After use, the peptide should not be stored in solution to prevent hydrolysis or degradation. Shipping is on blue ice for stability. The product is supplied as a lyophilized solid to maximize shelf life (APExBIO).

    Conclusion & Outlook

    The FLAG tag Peptide (DYKDDDDK) remains a gold-standard tool for protein purification and detection, delivering high purity, robust solubility, and flexible workflow integration. Its atomic design and enterokinase-cleavage site enable gentle and specific recovery of recombinant proteins. APExBIO's A6002 kit provides validated, peer-reviewed benchmarks for performance, making it suitable for both research and translational applications. Future advances may focus on improving tag accessibility, multiplexing capacity, and compatibility with emerging affinity reagents. For further detail on advanced usage and mechanistic underpinnings, readers can consult this guide on advanced tag design, which this article expands with quantitative product specifications and clarified experimental boundaries.